Questions? Feedback? powered by Olark live chat software
Permits and Restrictions

View Permits

Deposited As Candida heveanensis var. curvata Diddens et Lodder
Strain Designations NRRL Y-1511 [CBS 570, DBVPG 6206, DSM 101032, IFO 1159, JCM 1532, NCYC 476, VKM 2230, NBRC 1159]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colderFreeze-Dried: 2°C to 8°CLive Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Alkali-tolerant at pH 10Genome sequencing strain (RIKEN Center for Life Science Technologies, Japan;Ernst Moritz Arndt University, Germany)
Morphology After 3 days at 25°C, colonies cream to white and butyrous.  The cells are ovoidal to sausage shaped, often curved. 
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agarATCC® Medium 200: YM agar or YM brothATCC® Medium 324: Malt extract agar
Growth Conditions Temperature: 24°C to 26°C Atmosphere: Typical aerobic
Sequenced Data 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AATATGACGCAGCCATCACAGGTCACATTGATATGATATAGCCCGCCCGCAGATCATCTAATGATCTTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGATTTGCCTTCGGGCTAAACTATATCCATAACACCTGTGAACTGTTGATTGACTTCGGTCAATATTTTTACAAACATTGTGTAATGAACGTCATGTTATAATAACAAATATAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCTCTCTGGTATTCCGGAGAGCATGCCTGTTTGAGTGTCATGAAATCTCAACCATTAGGGTTTCTTAATGGCTTGGATTTGGACGTTTGCCAGTCAAATGGCTCGTCTTAAAAGAGTTAGTGAATTTAACATTTGTCTTCTGGCGTAATAAGTTTCGCTGGGCTGATAGTGTGAAGTTTGCTTCTAATCGTCCGCAAGGACAATTCTTGAACTCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGAGAATCATTAGTGATTTGCCTTCCGGCTAAACTATATTCATAAC

Morphology After 3 days at 25°C, colonies cream to white and butyrous.  The cells are ovoidal to sausage shaped, often curved. 
Name of Depositor NRRL
Chain of Custody ATCC
Isolation Sputum, the Netherlands
Cross References

Nucleotide (GenBank) : LDEP00000000 Cutaneotrichosporon curvatus strain SBUG-Y 855, whole genome shotgun sequencing project

Nucleotide (GenBank) : EU266558 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : BCJH00000000 Cryptococcus curvatus strain JCM 1532, whole genome shotgun sequencing project

Nucleotide (GenBank) : Y10422 delta-9 fatty acid desaturase gene, Ole1

Nucleotide (GenBank) : AF189834 26S ribosomal RNA gene, partial sequence

References

Diddens HA, Lodder J. Die anaskosporogenen Hefen, zweite Halfte. Amsterdam: North-Holland; 1942.

Fell JW, et al. Biodiversity and systematics of basidiomycetous yeasts as determined by large-subunit rDNA D1/D2 domain sequence analysis. Int. J. Syst. Evol. Microbiol. 50: 1351-1371, 2000. PubMed: 10843082

Aono R. Taxonomic distribution of alkali-tolerant yeasts. Syst. Appl. Microbiol. 13: 394-397, 1990.

Scorzetti G, et al. Systematics of basidiomycetous yeasts: a comparison of large subunit D1/D2 and internal transcribed spacer rDNA regions. FEMS Yeast Res. 2: 495–517, 2002. PubMed: 12702266

Takashima M, et al. Selection of orthologous genes for construction of a highly resolved phylogenetic tree and clarification of the phylogeny of Trichosporonales species. PLoS One 10: e0131217, 2015. PubMed: 26241762

Hofmeyer T, et al. Draft genome sequence of Cutaneotrichosporon curvatus DSM 101032 (formerly Cryptococcus curvatus), an oleaginous yeast producing polyunsaturated fatty acids. Genome Announc 4: e00362-16, 2016. PubMed: 27174275

Liu XZ, et al. Towards an integrated phylogenetic classification of the Tremellomycetes. Stud. Mycol. 81: 85-147, 2015. PubMed: 26955199

E: care@invitro.com.au
P: 1300 552 003